informacje



Pokazywanie postów oznaczonych etykietą chromatografia. Pokaż wszystkie posty
Pokazywanie postów oznaczonych etykietą chromatografia. Pokaż wszystkie posty

sobota, 5 sierpnia 2017

Kiedyś w laboratorium (57.)

Wielokrotnie w różnych wpisach pokazywałem wygodną i szybką metodę sprawdzania składu mieszanin poreakcyjnych, czyli chromatografią cienkowarstwową na wycinanej z arkusza płytce:

Jest prosta, pozwala dobrać skład eluentów, oraz często oddzielone składniki są bardzo ostro widoczne. Niemniej powtórzenie tego samego procesu z identycznym eluentem na kolumnie, często nie daje tak ładnych rezultatów. Oddzielone porcje podróżując wzdłuż kolumny rozmywają się i czasem zaczynają wtórnie na siebie zachodzić. Rozdział nie jest więc tak dobry jak to wyglądało na płytce.

Jednym z pomysłów na to jak rozwiązać ten problem, jest wykonanie rozdziału na bardzo dużej płytce - w systemie TLC preparatywnej:

Rozdzielony wyciąg z liści, widoczne pasma chlorofilu, karotenoidów i fityn
Taka płytka ma formę szklanej tafli o boku kilku lub kilkunastu centymetrów z nałożoną dość grubą warstwą podłoża rozdzielającego. Przy pomocy kapilarki lub pipetki nad dolną krawędzią płytki nakłada się poziomą krechę mieszaniny rozdzielanej, wielokrotnie powtarzają nakładanie. Następnie tak samo jak w małych płytkach, dolną krawędź zanurza się w eluencie. Potrzebna jest do tego odpowiednio duża komora, ja w jednym takim przypadku użyłem komory wielkości małego akwarium. Gdy płytka nasiąknie, krecha mieszaniny rozdziela się na długie pasy, zawierające oddzielone składniki. Aby je teraz ostatecznie oddzielić, bierze się nożyk lub szpatułkę o ostrym brzegu, i wydłubuje ten składnik, o jaki nam chodzi, zdrapując go ze szkła wraz z podłożem:
Zdrapiny zalewa się następnie jakimś mocnym eluentem aby wymyć oddzieloną frakcję. Można w ten sposób rozdzielać do około 0,5-1 g mieszaniny poreakcyjnej.

Ponoć można zdrapywać też plamki ze zwykłych, małych płytek, do celu badań jakąś bardzo czułą metodą analityczną, gdy dysponujemy małą ilością mieszaniny, wtedy do rozdziału wystarcza jedna kropla. Sam nigdy tego nie robiłem, ale słyszałem, że niektórzy się tak bawią.

wtorek, 29 listopada 2016

Chromatografia czarnych markerów

Czyli o tym, że czerń może się różnić od czerni.

Mając chwilkę czasu w laboratorium, zabawiłem się w rozdzielanie na składniki czarnych markerów, jakie były na stanie pracowni do szkła i plastiku:
W jaki sposób? Techniką jaka posłużyła mi do tego zadania, była chromatografia cienkowarstwowa.

O chromatografii kiedyś już pisałem (artykuł). Jest to technika rozdzielająca mieszaniny na poszczególne składniki, pozwalająca dzięki porównaniu ze wzorcami też na ich oznaczenie. Odkryta na początku XX wieku przez rosyjskiego botanika Cwieta stała się dziś jedną z podstawowych technik analitycznych.
Cały proces opiera się o zachodzenie dwóch przeciwstawnych zjawisk - adsorpcji substancji na powierzchni chłonnego materiału i jej wypieraniu przez cząsteczki rozpuszczalnika. To na ile mocno substancja zwiąże się z podłożem zależy w dużej mierze od tego co to jest za substancja i jakie jest to podłoże.
Na adsorbencie będącym materiałem polarnym, wchłaniającym wodę, łatwiej będą się osadzać substancje polarne, hydrofilowe, zaś aby je dobrze wymyć trzeba użyć także odpowiednio silnego, polarnego rozpuszczalnika. Podobne do podobnego. Siła oddziaływania substancji z podłożem zależy od budowy i wielkości cząsteczki - obecność atomów niemetali z wolnymi parami elektronowymi (tlen, siarka, azot) sprzyja tworzeniu wiązań wodorowych, które mocniej wiążą cząsteczkę. Dla układów gdy podłoże jest niepolarne, tłuste, siłę wiązania zwiększają grupy węglowodorowe. Duża cząsteczka niepolarna może się lepiej wiązać z niepolarnym podłożem niż mała.
Natomiast siła z jaką rozpuszczalnik wymywa substancję zależy od tego jak silnie z nią oddziałuje i od tego na ile silnie wiąże się z podłożem.

Wszystkie te efekty powodują, że różne substancje mają różną siłę osadzania się na materiale chłonnym, czyli różne powinowactwo. Jeśli umieścimy mieszaninę na początku masy adsorbenta i będziemy przepuszczać przez niego rozpuszczalnik, składniki najsłabiej oddziałujące z podłożem popłyną najszybciej, a te najmocniej popłyną najwolniej. Przypomina to sytuację gdy na stadionie sportowym do biegu na kilometr zgłosi się mieszanka młodzików i dobrze wytrenowanych sportowców - ci lepsi szybko oddzielą się od słabszych, tworząc osobną grupkę.
Spróbujmy zrozumieć na czym polega to zróżnicowanie prędkości. Powierzchnia ziaren podłoża jest na tyle duża, że rozpuszczona porcja substancji nie przepływa po prostu kanalikami, tylko zostaje cała skutecznie wyłapana i osadzona. Ale zarazem z tyłu czysty rozpuszczalnik wymywa substancję i przeprowadza przez nasycone ziarna do przodu, gdzie osadza się na jeszcze nie pokrytym podłożu. Bardziej więc przypomina to ruch wydmy gnanej wiatrem niż prosty przepływ. Jeśli substancja lepiej oddziałuje z podłożem, jest słabiej wymywana przez rozpuszczalnik. W efekcie więcej czasu pozostaje związana i zostaje w tyle za lepiej wymywanymi.
W ten sposób skomplikowane mieszaniny kilkunastu czy kilkudziesięciu składników mogą zostać rozdzielone.
Barwne składniki wyciągu z zielonych liści

W moim przypadku podłożem, adsorbentem, była cienka warstwa masy krzemionkowej osadzona na aluminiowej folii. Miałem do użytku na pracowni cały arkusz, który zużywałem przy kolejnych syntezach podczas sprawdzania, czy reakcja zaszła, a gdy został mi na koniec taki nierówno wycięty kawałek, postanowiłem użyć go do opisanego tu doświadczonka.
Na starcie, nad brzegiem płytki, naniosłem kropki czterema czarnymi markerami, jakie akurat miałem dostępne. Jako naczynia użyłem najmniejszej zleweczki i przykrywki od naczynka pomiarowego. Nie pamiętam jaki dokładnie był skład rozpuszczalnika, ale generalnie był to chlorek metylenu z odrobiną octanu etylu, bo tego akurat używałem.
Aby proces chromatograficzny zachodził, należało wytworzyć ruch rozpuszczalnika w materiale płytki, użyłem tu znanego zjawiska podciągania kapilarnego - wlałem do zlewki taką ilość rozpuszczalnika, aby cały dolny brzeg był zanurzony, ale też aby zarazem same plamki mi się w nim nie moczyły, i przykryłem całość nakrywką, aby nie parowało. Zanim płytka nasiąknęła co górnego brzegu minęło kilka minut, toteż film nakręcony podczas procesu trochę przyspieszyłem:



Jak widzicie cztery z pozoru identycznie czarne plamki rozwinęły się w różnokolorowe pasma.

Generalnie rzecz biorąc nie ma czarnych barwników. Czerń powstaje wtedy, gdy substancja pochłania tak dużo światła, że oko nie rejestruje konkretnego koloru. Zwykle jednak po mocnym rozjaśnieniu czerń okazuje się być bardzo, bardzo ciemnym konkretnym kolorem. Mogą istnieć czarne pigmenty, to jest stałe substancje pochłaniające w dużym stopniu wszystkie kolory światła, tu najczęściej używany jest węgiel. Trudno jednak zastosować pigment w farbach wodnych i w flamastrach, w których tusz z wkładu przesiąka do końcówki przez porowaty materiał, działający raczej jak sito dla stałych cząstek.
Producenci używają więc mieszanek różnych barwników o dużej sile barwienia. Gdy na dany barwnik pada światło białe, pochłania on z zakresu pewne kolory a odbija inne. Jeśli dobierzemy barwniki tak, że każdy kolor będzie po trochę pochłaniany, mieszanka będzie wyglądała na czarną. A jak pokazało moje małe doświadczenie, różni producenci lubią też używać różnych, unikalnych mieszanek:
Jak widać markery Granit i BIC mają podobny składnik podstawowy - dość polarny, intensywnie fioletowy barwnik, zostający z tyłu. Zastanawiałem się czy nie jest to aby fiolet krystaliczny, ale nie miałem gencjany do porównania. Jednak dalsze składniki różnią się wyraźnie - w jednym jest to łatwo rozpuszczalny brunatny składnik, w drugim dwa składniki, jeden żółtobrązowy drugi natomiast nieco różowawy. Może być on identyczny ze składnikiem markera trzeciego "Pilot", leżącym na tej samej wysokości. Tam podstawowym barwnikiem jest leżący niżej składnik granatowy.
W przypadku czwartego markera, Pentel Pen, składniki okazały się w układzie na tyle dobrze rozpuszczalne, że bez wyraźnego oddzielenia popłynęły na sam koniec, tworząc czarną plamkę.

Ten obraz poszerzyć może badanie wyglądu płytki w ultrafiolecie, ujawniające składniki nie widoczne gołym okiem. Substancje fluoryzujące świecą własnym światłem:
Jak widzimy pojawia się nam kolejna różnica między dwoma pierwszymi markerami - BIC zawiera dodatkowy składnik świecący w ultrafiolecie na jasno niebiesko. Możliwe, że w mniejszej ilości zawierają go też dwa po bokach, słabo świecące na tej samej wysokości. Takie świecenie na brzegu kolorowej plamy oznacza, że w zastosowanym układzie rozpuszczalników nałożyły się nam na siebie dwie substancje, a więc nie udało się ich zupełnie rozdzielić.
Po co niewidoczny gołym okiem składnik w markerach? Ponieważ świeci w ultrafiolecie, to musi go też pochłaniać, jest to więc zapewne składnik chroniący pozostałe barwniki przed degradacją na świetle, powstrzymujący blaknięcie rysunków.

Różnice w składzie tuszu markerów, ale też tuszu długopisów czy atramentu piór wiecznych mają istotne znaczenie w kryminalistyce, aby wyryć czy badane dokumenty, na przykład testament, nie były później uzupełniane. Jeśli sprawca użył innego długopisu, różny skład potwierdzi dopiski. Oczywiście nie wkładamy w tym celu dokumentu do naczynia z rozpuszczalnikiem aby spojrzeć na powstające kolorowe plamki. Bądź pobiera się drobną próbkę z dokumentu i bada którąś do dokładnych technik chromatograficznych, jak wysokosprawna cieczowa, bądź wyznacza technikami nieinwazyjnymi, jak spektroskopia Ramana czy UV-Vis

A jak wykonać podobne doświadczenie u siebie w domu? Specjalistycznych płytek TLC nie trzeba kupować. Za cienki materiał chłonny wystarczy arkusz grubej bibuły, na przykład gęsty filtr do kawy, można też próbować ze sztywnym, kredowym papierem. Mi kiedyś udało się to z papierem do kserowania.
Wycinamy z papieru pasek o takiej szerokości aby zmieściły się nam kropki wszystkich flamastrów jakie chcemy zbadać, długi na kilka centymetrów. Znajdujemy wysokie naczynie o płaskim dnie, może to być słoik, szklanka, opakowanie po czymś, tak aby nasz pasek się w nim mieścił.
Teraz kwestia rozpuszczalnika - dość dobrymi, mocno wymywającymi, jest spirytus i zmywacz do lakieru do paznokci. Jeśli okażą się zbyt mocne i podczas próby wszystkie kolory od razu pójdą do góry, możemy spróbować domieszać jakiegoś słabszego składnika, może to być na przykład jakiś rozpuszczalnik do usuwania tłustych plam. Jeśli badamy markery nierozpuszczalne, pomocne może być dodanie odrobiny wody - wprawdzie jest bardzo polarna, ale gdy składniki barwne się w wodzie słabo rozpuszczają, woda może pogorszyć ich wymywanie z papieru i spowolnić. Tu już trzeba sobie poeksperymentować.

Przygotowaną mieszankę wlewamy na dno naszego naczynia, wkładamy pasek papieru z naniesionymi u dołu kropkami markerów tak aby opierał się o ściankę. Ponieważ nasiąkający papier traci sztywność, aby się nam nie przewrócił i nie wpadł możemy bądź zawinąć górny brzeg na brzegu naczynia, lub użyć spinacza do papieru, ewentualnie przewlec nitkę przez otwór w papierze i podwiązać. Pasek nie powinien przylegać do ścianki naczynia, rozpuszczalnik będzie wówczas podsiąkał w szczelinie między nimi i całość się rozmyje. Naczynie czymś przykrywamy aby rozpuszczalnik nie parował i czekamy aż cały pasek nasiąknie.

czwartek, 14 kwietnia 2016

Ostatnio w laboratorium (51.)

Ostatnio w laboratorium rozdzielałem ciemną, zesmołowaną mieszaninę poreakcyjną na kolumnie z wypełnieniem krzemionkowym. Eluent (chloroform/metanol) miał współczynnik załamania na tyle zbliżony do ziaren krzemionki, że całość wydawała się przezroczysta. Dzięki czemu bardzo ładnie było widać, jak mieszanina rozdziela się na poszczególne składniki, tworzące osobne prążki:

Nałożyłem trochę za dużo i kolumna się przeładowała, ale to o co mi chodziło udało się oddzielić.

piątek, 11 grudnia 2015

Ostatnio w laboratorium (48.)

Ostatnio w laboratorium po skończeniu wydawałoby się prostego przekształcenia musiałem rozdzielić mieszaninę poreakcyjną, która wbrew przepisowi przybrała kolor brunatno-zielony. Gdy już z kolumny chromatograficznej zeszła większość frakcji, końcowe zanieczyszczenia rozwinęły się, ukazując swe dość intensywne, jak na to rozcieńczenie, i różnorodne kolory:
Cóż, gdyby nie to, że spieszę się aby do końca miesiąca przebrnąć przez najważniejszy etap syntezy katalizatora, wolałbym sprawdzić co też takiego dziwnego mi tu powstało. Na razie jedynie kolory te oznaczają, że powstała mi znaczna ilość produktów ubocznych, jakich tu być nie powinno, toteż chyba będę musiał użyć nieco mniej agresywnych reagentów...

czwartek, 26 listopada 2015

Dziś w laboratorium (47.)

Dziś w laboratorium po wyłączeniu dość prostej reakcji redukcji i rozwinięciu kropli, otrzymałem na płytce TLC oświetlonej ultrafioletem zjawiskowy wzór składników mieszaniny poreakcyjnej:
Wzór efektowny ale też nieco niepokojący bo oznacza, że reakcja która powinna zajść czysto i niemal ilościowo wytworzyła dużo więcej produktów o różnorodnych właściwościach niż to zakładałem.

wtorek, 18 lutego 2014

Rodział jonów niklu i kobaltu - chromatografia jonowymienna

Przegrzebując fotograficzne archiwa dotarłem do pierwszego roku studiów, na którym mieliśmy zajęcia z chemii nieorganicznej, i tam znalazłem kilka zdjęć dokumentujących pewne stare ćwiczenie, które chyba warto tu omówić.

Kobalt i Nikiel są pierwiastkami należącymi do raczej dziś już historycznej triady żelazowców. Wszystkie trzy wraz z żelazem charakteryzują się bardzo podobnymi właściwościami chemicznymi, podobieństwo w okresie jest większe niż w grupie. To metale, ferromagnetyki, chętnie występujące na +2 i +3 stopniu utlenienia. Właściwości ich soli są na tyle podobne, że rozdział metodami fizycznymi i chemicznymi jest trudny - o ile można to jeszcze przeprowadzić dla żelaza, to już kobalt i nikiel reagują tak samo.

Na samym początku przygotowaliśmy roztwory chlorku kobaltu II i chlorku niklu II, o różnych kolorach:
i zmieszaliśmy je ze sobą. Otrzymana mieszanka miała kolor brunatny. I co też tu teraz zrobić? A no napełnić kolumnę kationitem.

Substancje jonowymienne to bądź minerały i materiały ceramiczne bądź tworzywa sztuczne zawierające przyłączone do powierzchni grupy kwasowe lub zasadowe. W pewnym stopniu można je uznać za nierozpuszczalne kwasy i zasady. Przykładem może być choćby żel krzemionkowy, zawierający na powierzchni reszty kwasu krzemowego, albo polimer styrenowy z resztami kwasu siarkowego. Te "stałe kwasy" w odróżnieniu od takich nierozpuszczalnych substancji jak wolne kwasy tłuszczone, mają jednak specyficzną właściwość - chętnie dysocjują, zwłaszcza gdy mogą wymienić jony wodoru na jakieś inne kationy. Taki kationit zachowuje się w roztworach soli jak kwas siarkowy w proszku - zakwasza roztwór i tworzy sole, przy czym są to oczywiście sole przytwierdzone o podłoża polimerowego. Kation przyłącza się do podłoża i uwalnia jon wodorowy, który sam uwalnia się trudno.
Jest to cenna właściwość i korzysta się z niej wówczas, gdy potrzebne jest zakwaszenie ale nie potrzebne wprowadzanie nowych jonów pochodzących od reszt rozpuszczalnego kwasu. Bywa używany w modyfikacji klasycznej reakcji estryfikacji kwasu z alkoholem. Najczęstsze zastosowanie, z jakim co niektórzy mogą się spotkać w życiu codziennym, to zmiękczanie wody - po dodaniu kationitu z przyłączonym sodem, jony wapniowe i magnezowe przyłączają się do niego.

Szczególnym przypadkiem jest otrzymywanie wody dejonizowanej - wówczas woda przepuszczana jest przez bęben z wypełnieniem kationitu, który wyłapuje kationy, a potem przez bęben wypełniony anionitem, który pochłania aniony. Uwolnione kationy wodorowe i aniony hydroksylowe zobojętniają się i powstaje nam czysta, pozbawiona soli woda, jest to szybsze i bardziej energooszczędne od wielokrotnej destylacji.

Zużyty jonit można zregenerować - ten kwasowy przemywając roztworem mocnego kwasu, ten sodowy przemywając stężonym roztworem soli (tak właśnie zmywarki do naczyń regenerują kationit zmiękczający i do tego potrzebna jest sól do zmywarek).

Jak jednak ma się to do rozdziału jonów?
Do podłoża przyłączać mogą się różne jony, przy czym siła tego wiązania zależy od właściwości jonu. Powinowactwo kationu metalu do grupy sulfonowej w dużym stopniu zależy od ładunku, toteż kationy dwudodatnie jak Ca2+ będą przyłączane chętniej niż jednododatnie jak Na+ . W przypadku jonów o tym samym ładunku znaczenie ma też siła tego ładunku zależna od liczby atomowej i wielkości jonu, co wpływa na zagęszczenie ładunku. Jon silniej wiążący się z podłożem, będzie  wypierał jon słabiej związany. Wypieranie następuje też gdy jon słabszy występuje w dużym stężeniu.

Jak to wszystko ma się do rozdziału pierwiastków?
Nasze pierwiastki, kobalt i nikiel, leżą obok siebie w układzie okresowym, ich atomy mają podobną wielkość, jednak między kationami występuje niewielka różnica - kation niklu jest większy. Wobec tego ładunek na zewnątrz kationu jest mniej zagęszczony a sam kation jest słabiej wiązany do kationitu. Różnica jest niewielka, ale wystarczająca. Gdy nałożymy mieszankę obu pierwiastków na kolumnę kwaśnego żelu i będziemy przemywali ją kwaśnym roztworem, wymywającym kationy przez wypieranie, słabiej związany nikiel będzie po pierwsze bardziej wymywany przez eluent a po drugie nieco bardziej wypierany przez silniej wiążący kobalt. Ta niewielka różnica doprowadzi do tego, że kation niklu oddzieli się od kobaltu i będzie szybciej przepływał przez wypełnienie. Dzięki temu dokona się rozdział.

Tak więc na początek napełniłem szklaną kolumnę sypkim wypełnieniem, i przepłukałem wodą destylowaną, następnie przepłukałem kolumnę zasadowym buforem cytrynianowym mającym za zadanie zdeprotonować powierzchnię i usunąć wszystkie kationy. Przemywałem kolumnę tak długo aż odczyn wycieku stał się obojętny. Teraz przepłukałem ją ponownie ale roztworem kwasu, był to chyba rozcieńczony kwas solny, aby sprotonowac wszystkie grupy. Całość należało teraz przemywać wodą tak długo, aż wyciek będzie obojętny. Żel podczas tych manipulacji to puchł to kurczył się. Taka kolumna była już gotowa do użytku:

Na szczyt kolumny nalałem mieszankę soli, które zostały silnie zaabsorbowane, tworząc brunatną warstewkę:

Pochłonięte kationy dosyć dobrze związały się z podłożem, dlatego kolumnę przemyłem jeszcze wodą, aby odmyć aniony, po czym zacząłem przepłukiwać ją kwaśnym roztworem. Kationy ruszyły w dół i zaczeły rozdzielać się na szybsze zielone i wolniejsze różowe pasmo.
 
Teraz należało obserwować kolor wycieku i podstawić w odpowiedniej chwili odbieralniki, najpierw na frakcję zieloną:

a potem na różową:

I tak dwa bardzo podobne pierwiastki zostały oddzielone.

W praktyce używa się tej techniki do rozdziału lantanowców - bardzo cennych pierwiastków mających zastosowanie w technice i elektronice (na przykład neodym), o praktycznie identycznych właściwościach fizycznych, występujących na raz w tym samym minerale. Można też w ten sposób rozdzielać związki organiczne, na przykład aminy w formie kationów amoniowych.

poniedziałek, 18 listopada 2013

Synteza I. - etap pierwszy, męczący

Dawno dawno temu... jeszcze przed wakacjami, obiecywałem że zacznę pisać o syntezach wykonywanych w ramach pracowni magisterskiej. Niestety jak widać zrobił mi się w tej kwestii znaczny poślizg, co zresztą dotyczy wszystkich dłuższych postów. Ledwie coś zacznę, tracę zapał do dokańczania i odkładam rzecz na później. To "zatwardzenie pióra" sprawia że wolę już niczego nie obiecywać.

Skoro już w jednym z wcześniejszych wpisów obszernie objaśniłem o co chodzi z tymi syntezami asymetrycznymi, mogę przejść do opisu pierwszej wykonywanej syntezy, jeszcze z poprzedniego roku studiów. Wówczas to, w drugim semestrze czwartego roku, mając czas przeznaczony na laboratorium w wymiarze jednego dnia tygodniowo, raczej wprawiałem się i wdrażałem do pracy laboratoryjnej, toteż to co robiłem było raczej powtórzeniem już przeprowadzanej syntezy, a nie rozpoczynaniem czegoś nowego. Miało to tą dobrą stronę, że w razie wątpliwości mogłem zajrzeć do notatek osoby robiącej to samo w zeszłym roku.

Moim związkiem końcowym miała być 3-bromo-5-fenylo-1,2,4-triazyna, a uzyskać ją miałem z wyjściowych związków niecyklicznych. Całość reakcji powinna wyglądać tak:


Pierwszy etap który omówię w tym wpisie, dotyczył cyklizacji i wyodrębnienia produktu.
Substratami wyjściowymi był fenyloglioksal i karbamohydrazonotioester metylowy (chyba, po angielsku Methyl carbamohydrazonothioate) w formie jodowodorku. Ten drugi jest tu dostarczycielem dwóch azotów połączonych wiązaniem; grupa tioestrowa jest tu sposobem zabezpieczenia grupy hydroksylowej, która w przeciwnym wypadku też mogłaby wchodzić w reakcję. W obecności słabej zasady, jaką jest wodorowęglan sodu następuje kondensacja grup aminowych do węgli karboksylowych, tworząc sześcioczłonowy pierścień:

Możliwy produkt uboczny, z podstawnikami w ustawieniu 3,6 (a więc para-trizyna), nazywany dalej izomerem 6, powstaje gdy cząsteczki połączą się obrócone, jest go jednak mało, o czym później.
Zgodnie z przepisem odważyłem fenylogliokasal, mający w tym przypadku postać żółtawego proszku o bardzo niemiłym zapachu - dosyć ostrym, jakby czosnkowym ale z kwaśną nutą. Podobnie pachniał kiedyś słoik zepsutych kiszonych ogórków. 

Drugi związek miał formę białego proszku, przechowywano go w lodówce z uwagi na niestabilność. Glioksal i węglan sodu rozpuściłem w kolbie i dodałem drugi substrat. Całość umieściłem na mieszadle magnetycznym (wcześniej wrzuciłem magnetyczny drops), obłożyłem z zewnątrz lodem  i tak to się miało kręcić całą dobę.

Kolejnego dna po ostatnim wykładzie przyszedłem zobaczyć co wyszło. A wyszło mianowicie to, że zastałem w kolbce żółtawą mieszaninę poreakcyjną. Należało ją teraz rozdzielić. Najpierw ekstrahowałem ją chlorkiem metylenu aby oddzielić węglan sodu i częściowo zhydrolizowany hydrazyd, otrzymując brązowy roztwór:

Potem oczywiście nałożyłem na kolumnę i rozdzieliłem chromatograficznie. Wcześniejsze próby na płytce pokazały że w ekstrakcie miałem głównie pożądany produkt i ślady izomeru 6, możliwe do rozdzielenia. Kwestię rozdziału na kolumnie preparatywnej, jej wykonywanie i problemy z tym związane, już tu omawiałem, więc nie będę się u szczegółowo powtarzał. Początkowo użyłem mieszanki CH2Cl2:metanol 100:1 która na płytce dawała dobre rezultaty. Niestety na kolumnie nie specjalnie.
Związek główny strasznie ogonował - za czołem zawierającym główną porcję ciągnął się "ogon" zawierający produkt, co oznaczało że do całkowitego wymycia potrzebne jest przelanie przez kolumnę dużej ilości eluentu. Zdaje się że zużyłem w ten sposób ponad pół butelki chlorku metylenu zbierając 12 frakcji aż prowadząca uznała, że lepiej użyć mieszanki z większa ilością metanolu i dopiero wówczas związek wymył się całkiem.
Kolejnego dnia miałem zająć się przede wszystkim odparowaniem czystych frakcji na wyparce. Jest to przyrząd w którym roztwór umieszczony zostaje w kulistej kolbie zanurzonej w misie z ciepłą wodą i podłączony do chłodnicy pod obniżonym ciśnieniem. Kombinacja niskiego ciśnienia, podgrzewania i rozprowadzania cieczy na ściankach powoduje szybkie odparowanie rozpuszczalnika.

Tak więc nalewałem do kolby kolejne frakcje, i odparowywałem. Pierwsza, drugą, trzecią, czwartą, piątą... a gdy byłem przy dziesiątej zdarzyła się katastrofa. 
Kolbka podłączona do wyparki trzyma się obracającego szlifu trochę za sprawą tarcia a trochę za sprawą przyssania. Dla pewności można założyć plastikowy klips. Gdy odparowałem już wszystkie wcześniejsze frakcje, odszedłem na chwilę a przez ten czas z tej samej pompy ssącej skorzystał ktoś inny aby coś sobie przesączyć. I wyłączył pompę. Gdy powróciłem nie zwróciłem na to uwagi - wlałem do kolbki jedenastą frakcję, nasunąłem ją na szlif, zanurzyłem w misie i włączyłem obrót. Kolbka obróciła się kilka razy i wpadła do misy...
Oczywiście nie do końca odparowany roztwór wylał się do środka i będąc cięższym od wody osiadł na dnie. Łatwo sobie wyobrazić moją reakcję. No ale cóż, nie było na co się dalej złościć, trzeba było ratować co się da. Wybrałem wodę z misy po czym odciągnąłem roztwór z dna pipetką. Zanieczyszczony różnymi osadami z dna i wodą roztwór wlałem do kolby i zasypałem środkiem suszącym. I tak skończył się dzień kolejny.
Na następnej pracowni odparowałem ocaloną frakcję produktu, po czym nałożyłem wysuszoną i przesączoną mieszaninę powypadkową, po czym... nałożyłem na kolumnę i rozdzielałem.

Tym razem poszło mi to szybciej za sprawą lepiej dobranego układu, ale też zeszło na to trochę czasu. Na koniec porównałem obie części ze wzorcem produktu i odparowałem wspólnie, w jednej kolbie, otrzymując 1,5 grama związku. Po odparowaniu początkowo utworzył olejek, który ładnie wykrystalizował:

Porządnie mnie wymęczył ten etap.

czwartek, 10 października 2013

Ostatnio w laboratorium (34.)

Na jednej z pierwszych pracowni po wakacjach, miałem się zająć oczyszczaniem substancji otrzymanej jeszcze przed nimi, bowiem pierwotnie kremowa bromofenylotriazyna niepokojąco zbrązowiała przez te trzy miesiące. Oczywiście aby oczyścić, musiałem nałożyć ją na kolumnę chromatograficzną, a aby zrobić kolumnę musiałem nasączyć proszek suchej krzemionki odpowiednim rozpuszczalnikiem, aby otrzymać żel. W trakcie tego procesu sfilmowałem interesujące zjawisko:
 
Z kilku punktów na powierzchni proszku strzeliły "wulkany pyłowe" nie większe niż kilka centymetrów. Jak łatwo domyśleć się wywołało je powietrze zawarte między luźnymi ziarnami krzemionki, wypierane przez szybko wchłaniany rozpuszczalnik. Najwyraźniej był wchłaniany na tyle szybko, że powietrze w porach nabrało ciśnienia i wypływając na powierzchnię porywało część proszku. Ciekawe.
Skądinąd przyczynia się do tego mała gęstość i niska lepkość chlorku metylenu użytego w tym przypadku, z heksanem czegoś takiego nie obserwowałem.

Ciekawi mnie czy coś podobnego może występować na pustyniach gdy pylisty piasek podsiąka wodą spływającą jakimś wąwozem od odległej ulewy Niewykluczone że tak jest, a tylko nie chciało się nikomu przyglądać.

czwartek, 8 sierpnia 2013

Kiedyś w laboratorium (30.)

Podczas rozdziału mieszaniny poreakcyjnej na kolumnie preparatywnej, należy wyłapać kiedy z kolumny zaczyna schodzić któraś z rozdzielonych substancji. Jeśli dana frakcja jest silnie zabarwiona, nie powinno nastręczać to trudności - po prostu podstawiamy pod kurek wylotu kolbkę, gdy tylko frakcja zacznie skapywać, i odstawiamy gdy przestanie.
Niestety nie zawsze frakcje mają wyraźne zabarwienie, a gdy czoło oraz tył wędrującej porcji są dosyć rozcieńczone, bardzo trudno jest na oko wyłapać kiedy już się zaczyna i kiedy już się kończy. Niestety też dotyczy to większości przypadków, a gdy teoretycznie naszego produktu ma powstać bardzo malutko, rzędu 100-200 mg, utrata choćby kilku kropel da już zauważalny spadek wydajności.

Więc co się robi? A no bierze się przy pomocy szklanej kapilarki odrobinę roztworu - w taką kapilarkę zmieścić się może jedna-dwie krople - i nakrapla na płytkę używaną do chromatografii. Takie płytki często są domieszkowane dodatkami fluoryzującymi w ultrafiolecie. Jeśli w kropli jest sam rozpuszczalnik, to zwykle nie zmienia on świecenia, jeśli jest tam rozpuszczona jakaś substancja pochłaniająca ultrafiolet, to miejsce na pytce jest ciemniejsze, zwykle z różowawym odcieniem. Ideałem jest sytuacja gdy interesująca nas frakcja świeci w ultrafiolecie:

Dzięki temu łatwiej jest ją wyłapać. Procedura polega zatem na tym, że pobieramy co chwila takie próbki prosto ze strumienia i sprawdzamy na jakiejś wolnej płytce pod lampą UV do momentu, gdy w czystym rozpuszczalniku pojawią się ślady frakcji. Wtedy postawiamy pod wylot kolbkę odbieralnika i znów sprawdzamy skład wycieku do chwili, aż frakcja całkiem zaniknie. Na poniższej płytce dobrze widać powolny spadek stężenia aż do zaniku:
W tym przypadku triazyna świeciła niebieskawo z fioletowawym odcieniem.

...a teraz jadę na zjazd miłośników astronomii w Niedźwiadach, więc nowe wpisy dodam po powrocie.

poniedziałek, 15 lipca 2013

Napełnianie kolumny preparatywnej

Gdy chemik rozpocznie syntezę celem stworzenia potrzebnej mu substancji, po przeprowadzeniu całego procesu otrzymuje mieszaninę poreakcyjną. Znajduje się tam zarówno pożądany produkt, jak i produkty uboczne, nie przereagowane substraty i różne inne zanieczyszczenia. Idealna jest sytuacja, gdy pożądany produkt wyraźnie różni się właściwościami od całej reszty - przykładowo jest nierozpuszczalny w medium reakcyjnym. Wtedy oddzielenie i przekrystalizowanie jest łatwe. Problem pojawia się gdy wszystkie składniki są do siebie pod tym względem podobne.
Standardową techniką do rozdziału takich mieszanin, jest preparatywna chromatografia flashowa.

Techniki chromatograficzne wykorzystują różnicę w oddziaływaniu różnych składników mieszaniny z podłożem chłonnym i rozpuszczalnikiem. Po nałożeniu mieszaniny na początek kolumny wypełnionej absorbentem, lub pokrytej nim płytki, i wymuszeniu przepływu rozpuszczalnika, składniki silniej oddziałujące zostają w tyle za słabo oddziałującymi i tym samym szybciej wymywanymi. W idealnej sytuacji każda substancja przesuwa się przez kolumnę z własną prędkością i niczym ruchoma wydma oddziela się jako osobny barwny prążek od pozostałych. Wówczas można je od siebie oddzielić.
Na tym właśnie polega rozdział mieszanin poreakcyjnych - nakładamy naszą substancję na początek szerokiej rury wypełnionej żelem absorbentu i dolewając od góry rozpuszczalnik wymuszamy grawitacyjny ruch do dołu. Gdy mieszanina porozdziela się, w odpowiednim momencie podstawiamy kolbki pod kurek wylotu, zlewając frakcje zawierające poszczególne składniki. Proste.
Tyle tylko, że ruch rozpuszczalnika pod wpływem samej grawitacji jest zwykle dosyć wolny, co powoduje że całość rozdziału trwać może dosyć długo, dlatego w tej prostej technice "popychamy" go lekkim nadciśnieniem uzyskiwanym przez ręczną pompkę. Chromatografowanie trwa wtedy krótko, jest szybkie (flash) i stąd określenie chromatografia flashowa.

Kolumny nie są jednak zazwyczaj używane jednorazowo - samo naczynie szklane jest używane wielokrotnie, będąc napełniane świeżym i opróżniane ze zużytego wypełnienia. Na kilku zdjęciach postaram się przedstawić jak napełnianie kolumny wygląda od strony praktycznej.

Kolumna chromatograficzna ma postać szklanej rurki, z jednym końcem zamkniętym zaworem z kurkiem. Na samym początku należy przytkać ten wylot tak, aby nie uciekało nam wypełnienie, ale mógł przechodzić rozpuszczalnik. Do środka wrzucamy kłębek waty i wpychamy w wylot prętem:

Gdy rurka jest uszczelniona, wlewamy na dno nieco rozpuszczalnika, aby wypchnąć powietrze z waty. Drobne pęcherzyki by potem przeszkadzały. Bierzemy teraz nasze wypełnienie, zwykle jest to tlenek krzemu lub glinu, w formie bardzo drobnego proszku. Wsypujemy go do zlewki i zalewamy taką ilością rozpuszczalnika, aby otrzymać bardzo rzadkie błotko:

Taka mieszanina jest tiksotropem - mieszana i wstrząsana jest dosyć rzadka, ale po odstawieniu szybko rozdziela się i zagęszcza, dlatego jej wlewanie do pustej kolumny nie jest tak znów łatwe. Ja zwykle w trakcie wlewania mieszałem ją pręcikiem, aby pozostawała półpłynna.

Kolumnę napełniamy błotkiem w około 90% wysokości, i pozwalamy się ustać spuszczając część rozpuszczalnika, zaś aby z masy wyleciały pęcherzyki powietrza, należy lekko wstrząsać całość kolumny, my uderzaliśmy ją lekko z boku gumową rurką. Podczas takiego obsiadania masa trochę się kurczy, i konieczna może być dolewka, dlatego właśnie lepiej przygotować sobie nieco więcej.
Resztki wypełnienia z górnej części kolumny trzeba spłukać rozpuszczalnikiem.

Jeśli chodzi o nakładanie mieszaniny na początek kolumny, to mamy tu dwie filozofie - gdy mieszaniny jest mało, rozpuszczamy ją w rozpuszczalniku i wlewamy do kolumnę, po czym spuszczamy rozpuszczalnik tak, aby ciecz została całkowicie wchłonięta. Aby nie wzburzać powierzchni wypełnienia z wchłoniętą mieszaniną podczas wlewania czystego rozpuszczalnika, można nasypać tam bądź czystego wypełnienia bądź jakiejś sypkiej, ciężkiej i obojętnej substancji. My używaliśmy tu bezwodnego siarczanu magnezu, co przy okazji wychwytywało ślady wody.
Po nałożeniu dolewamy czystego rozpuszczalnika do dodatkowego zbiornika nasadzanego na szczyt kolumny, i popychamy ręczną pompką. I tak zaczyna się rozdział.




Inna możliwość, używana gdy mieszaniny jest dużo lub słabo się rozpuszcza, to rozpuścić ją i dosypać do roztworu wypełnienia, po czym wysuszyć. Suche wypełnienie z pochłoniętą mieszaniną po zwilżeniu umieszcza się na już wypełnionej kolumnie, dzięki czemu unikamy rozmycia podczas nasączania.
Może w tym semestrze uda mi się zmontować materiał filmowy przedstawiający napełnianie kolumny i inne podstawowe czynności.



środa, 20 lutego 2013

Chromatograficzne oznaczanie zawartości kofeiny w herbacie

W ostatnim czasie trochę nie bardzo miałem czas na wpisy na blogu, zwłaszcza że te dopiero przygotowywane są dłuższe i wymagają większej pracy, dlatego aby nie zaniedbać tego miejsca całkowicie, przedstawię coś wygrzebanego z archiwum notatek.

Kofeina jest naturalnym alkaloidem zawierającym azot, o właściwościach lekko zasadowych, wstępującym w wielu roślinach, głównie w krzewie kawowym i krzewie herbacianym. Napoje otrzymywane z tych roślin nie miały by dla nas wielkiej wartości gdyby nie ów związek, a to z powodu pobudzających właściwości. Kofeina zmniejsza poczucie zmęczenia, rozszerza naczynia krwionośne, pobudza wydzielanie soków żołądkowych i moczu, zwiększa wydzielanie neuroprzekaźników dając krótkotrwały efekt "jasności umysłu"; niestety jak wszystkie substancje wpływające na percepcję prowadzi do fizycznego uzależnienia, choć lekkiego. Dlatego też ludzkość spożywa ją tonami.

W ćwiczeniu jakie wykonywaliśmy na zajęciach chodziło wprawdzie o oznaczenie ilości kofeiny w herbacie, ale główną sprawą na jaką zwracano naszą uwagę, był sposób przygotowania próbki - konkretnie zaś technika SPE.

W procesie analitycznym samo badanie i interpretacja wyników stanowią dosyć krótki etap, natomiast przygotowanie próbki tak, aby można było ją zbadać niejednokrotnie okazuje się najbardziej czasochłonną częścią. W dodatku musi być to etap wykonany dokładnie, bo choćby sprzęt pomiarowy był supernowoczesny, to wynik oparty o badanie złej próbki nadaje się tylko do kosza. Dlatego też sposoby przygotowania próbek to dziedzina równie szeroka i dynamiczna jak metody analityczne. Jednym z tych sposobów jest ekstrakcja do fazy stałej czyli właśnie SPE.
W pewnym stopniu można zaliczać SPE do chromatografii, gdyż i tutaj i tu używa się kolumny wypełnionej adsorbentem, różnica jest jednak taka iż w chromatografii stosujemy ciągły przepływ rozpuszczalnika, chcąc uzyskać ruch w kolumnie, z różnymi prędkościami, składników analitu; natomiast w SPE chodzi o to, aby to co zostanie wchłonięte, pozostawało na adsorbencie tak długo jak to nam będzie potrzebne. Właściwie jest to technika mająca pomóc oddzielić to co nas interesuje od tego co nam przeszkadza, a często też mogąca zagęścić składnik występujący w śladowych ilościach.

Na przykład mamy do czynienia ze ściekami, w których chcemy oznaczyć benzen. Ścieki zawierają całe mnóstwo składników o różnorodnych właściwościach, przez co niektóre czułe detektory mogą zostać całkiem zdezorientowane, należy zatem oddzielić to co niepotrzebne, a więc sole, białka, aminokwasy, kwasy organiczne, alkohole i cokolwiek innego, od frakcji właściwej, zawierającej niepolarne rozpuszczalniki organiczne. Przepuśćmy więc nasz roztwór przez jakiś niepolarny adsorbent, który będzie takie rozpuszczalniki dobrze pochłaniał. Niepolarne substancje zostaną pochłonięte, zaś polarne będzie można wypłukać czystą wodą. Teraz przepłuczmy nasz absorbent czymś, co może wypłukać niepolarne substancje, na przykład heksanem, a otrzymamy roztwór zdecydowanie prostszy w analizie, bo zawierający wyodrębnione ze ścieków same tylko substancje niepolarne, w tym nasz benzen. Jeśli w dodatku przedtem występował w próbce w niewielkich ilościach, to po wymyciu z adsorbenta niewielką ilością rozpuszczalnika zdecydowanie się zatęży. Odwrotnym przypadkiem jest przepuszczanie próbki przez adsorbent, na którym zatrzymają się przeszkadzające zanieczyszczenia.
I to jest w zasadzie cała istota techniki.

Przemywania dokonuje się zazwyczaj w krótkich, szerokich kolumienkach, przypominających strzykawki, często przepływ przyśpiesza się podłączając wylot kolumienki pod niższe ciśnienie

W techniczne szczegóły nie będę się tu na razie wdawał, czas bowiem przejść do opisu ćwiczenia.

Na początek wzięliśmy kilka torebek herbaty ekspresowej (chyba "Minutki") i po rozerwaniu odmierzyliśmy dokładnie 0,85 g, po czym wsypaliśmy do kolby. Zaraz potem wsypaliśmy tam 2 g tlenku magnezu:

I dolaliśmy gorącej wody. Wyciąg należało zaparzać przez kwadrans. Po co tlenek magnezu? Zmieszany z wodą częściowo reagował dając wodorotlenek, i nadając roztworowi łagodnie zasadowy odczyn. W normalnej sytuacji kofeina tworzy z garbnikami herbacianymi mało rozpuszczalne połączenia, więcej jest ich w herbacie zielonej stąd też może mieć ona słabsze działanie pobudzające niż czarna. Zasadowe środowisko powoduje rozpad tych połączeń i większy stopień ekstrahowania z fusów. Ponadto w takich warunkach kofeina nie przechodzi  formę jonową, co ma znaczenie dla dalszego przebiegu ćwiczenia. Gdy nasza herbatka była już gotowa, należało ją przesączyć, oddzielając fusy i tlenek magnezu.
użyta kolumienka zawierała jako adsorbent żel krzemionkowy C-18, to jest z przyłączonymi do powierzchni osiemnastowęglowymi łańcuchami węglowodorowymi. Takie wypełnienie jest zatem bardzo niepolarne. Kofeina w formie niejonowej jest bardzo słabo polarna, mimo całkiem sporego momentu dipolowego, dlatego jest pochłaniana. Zanim jednak przepuściliśmy przez kolumienkę nasz roztwór, przepłukaliśmy ją metanolem, aby dotychczas suchy adsorbent był gotowy do pracy, zaś łańcuchy C-18 mogły się rozprostować.

Nabralliśmy 2 ml naparu i przepuściliśmy przez kolumienkę, której wypełnienie zabarwiło się na brązowo:

Gdy już wszystko zostało wchłonięte, przepłukaliśmy kolumienkę metanolem z wodą amoniakalną, aby wypłukać to co nie potrzebne, a na sam koniec wysuszyliśmy złoże, to jest, pozwoliliśmy aby podciśnienie zassało przezeń powietrze.
Tak więc potrzebną frakcję substancji niepolarnych - w tym kofeiny - mieliśmy już wchłoniętą. I czym ją teraz wypłukać? Moglibyśmy użyć rozpuszczalnika organicznego, ale ten wypłukałby nam wszystko co tam jest, a już po brązowym kolorze wypełnienia można było poznać, że oprócz kofeiny jest tam wiele innych związków. Przypomnę teraz że kofeina,, jak wszystkie alkaloidy, zawiera azot o właściwościach zasadowych - a więc mogący przyjmować proton. Po przyjęciu protonu alkaloid przechodzi w formę jonową z ładunkiem dodatnim. A taka forma jest dobrze rozpuszczalna w wodzie i słabo adsorbowania na podłożach niepolarnych.
Zatem przepłukaliśmy naszą kolumienkę mieszaniną wody, metanolu i kwasu octowego, uzyskując żółtawy roztwór, zawierający kofeinę i niezbyt dużą ilość przeszkadzających zanieczyszczeń. Najwyraźniej niektóre garbniki mają na tyle zbliżone właściwości aby przechodzić przez kolejne etapy w podobny sposób.

Dalsza analiza została przeprowadzona za pomocą chromatografii cieczowej - szerzej opisuję ją w tym wpisie . Najpierw na kolumnę nastrzyknięto próbkę wzorca kofeiny, o stężeniu 0,05 µg/ml, otrzymując chromatogram z pikiem o czasie retencji 14,293 minuty. Potem wstrzyknęliśmy próbkę z przygotowanego przez nas roztworu, uzyskując podobny pik o tym samym czasie retencji, muszący być analizowanym związkiem. Pola pod pikami wynosiły 1 224 259 jednostek względnych dla wzorca i 731 882 dla próbki analizowanej. Detektor fotometryczny mierzył absorpcję w ultrafiolecie dla fali 272 nm.
Znając masę próbki, stężenia wzorców i wiedząc jaki procent pierwotnej próbki stanowiła ta ostateczna, można było wyliczyć zawartość kofeiny w herbacie na 5% suchej masy, co stanowi dość dużą wartość (źródła podają zwykle, że dla herbaty zawartość nie przekracza 4,5%), choć oczywiście w normalnym przypadka nie cała ilość przechodzi do naparu.
Nie taka zła ta herbata

poniedziałek, 4 lutego 2013

Ostatnio w laboratorium (21.)

Jakoś tak wyszło że ostatnimi zajęciami laboratoryjnymi przed sesją egzaminacyjną, były te z chemii instrumentalnej. Nasze zadanie polegało na przygotowaniu roztworów wyciągów roślinnych do badania zawartości polifenoli, w układzie chromatografu cieczowego z detektorem elektrochemicznym.
Ponieważ polifenole łatwo się utleniają, a zwłaszcza w podwyższonej temperaturze, nie mogliśmy zrobić naparu, dlatego zalaliśmy wybrane zioła metanolem i włożyliśmy do płuczki ultradźwiękowej, aby się wyekstrahowały:

W takim urządzeniu próbki poddawane są działaniu ultradźwięków wywołujących we wnętrzu szybkie fluktuacje ciśnienia. Powodują one zniszczenie struktur biologicznych i ułatwiają wnikanie rozpuszczalnika wgłąb cząstek stałych, z tego też powodu ostrzeżono nas abyśmy podczas wkładania próbek do działającej płuczki, nie włożyli tam przypadkiem palca.
Po takim dokładnym przewibrowaniu przesączyliśmy nasze roztwory, mające już zielonkawy kolor, i przelaliśmy do wyparki:

Wyparka to kolba kulista połączona z pompką próżniową i chłodnicą wykraplającą opary. Obrót kolby, rozprowadzający roztwór po ściankach, łaźnia ogrzewająca i wreszcie obniżone ciśnienie sprzyjają szybkiemu odparowywaniu rozpuszczalnika, toteż całe urządzenie jest używane do zagęszczania rozcieńczonych próbek. W naszym przypadku każdy roztwór nabrał zdecydowanie wyraźniejszych kolorków:
W naszym przypadku użytymi ziołami były, od lewej: dziurawiec, liść poziomki i szałwia. Zawartości polifenoli już nie pamiętam, ale nie stwierdziliśmy jakiś nadzwyczajnych odstępstw.


wtorek, 8 stycznia 2013

Kiedyś w laboratorium (20.)

W zeszłym roku na zajęciach z chromatografii zajęliśmy się między innymi analizą cukrów. Na płytki nanosiliśmy po kropli cukrów: rybozy, mannozy, laktozy, glukozy i kroplę analizowanej mieszaniny X. Niektóre płytki były wcześniej modyfikowane przez nasycenie kwasami organicznymi. O ile dobrze pamiętam użytym roztworem rozdzielającym była mieszanina octanu etylu i izopropanolu z wodą. Następnie płytki wysuszyliśmy i spryskaliśmy wywoływaczem - kwaśnym acetonowym roztworem difenyloaminy. I wtedy okazało się, że ćwiczenie nie wyszło - plamki ledwie drgnęły. Jako tako wyszła tylko jedna płytka rozdzielana w jednym układzie, została jednak źle spryskana i po wywołaniu zamiast plamek ujrzeliśmy marmurkowaty deseń:


Bywa i tak.

poniedziałek, 12 marca 2012

Elektroforeza DNA

Mam w tym roku zajęcia z biochemii i oczywiście dokumentuję wykonywane ćwiczenia, a niektóre są bardzo ciekawe. Ostatnio przerabialiśmy elektroforezę. W zasadzie główne ćwiczenie dotyczyło elektroforezy białek na żelu PAG, ale to nie zbyt się nam udało. Równocześnie jednak prowadzący zajęcia postanowił pokazać nam coś ekstra a mianowicie elektroforezę DNA - a więc taki typ badania, z którego korzysta się na przykład przy ustalaniu ojcostwa.

Elektroforeza
to technika analityczna w dużej mierze zbliżona do chromatografii, w niektórych podręcznikach klasyfikowana jako jeden z jej działów. Zasadniczo główną zasadą rozdziału mieszanin jest tu skorzystanie ze zjawiska ruchu jonów w polu elektrycznym. Każda cząstka naładowana znalazłszy się w polu elektryczny zaczyna być przyciągana w kierunku elektrody o przeciwnym znaku. Aniony zbliżają się do dodatnio naładowanej anody a kationy do ujemnie naładowanej katody. Już to może stać się podstawą rozdziału prostych substancji, bardzo ładny przykład widać w tym filmiku, gdzie żółty anion chromianowy oddziela się od niebieskiego katjonu kompleksowego tetraaminamiedzi. Zasadnicza różnica między migracją jonów a elektroforezą jest ta, że w tym drugim przypadku wędrują duże cząsteczki naładowane, na przykład stałe cząstki koloidu, wielkomasowe białka albo takie cząsteczki jak kwas deoksyrybonukleinowy.
Sam ruch cząstek nie miał by wielkiego znaczenia dla analityki, gdyby nie fakt, że różne cząsteczki poruszają się z różną prędkością. W zasadzie szybkość ruchu jest tym większa, im większy niesie ładunek, i tym mniejsza im większa jest to cząsteczka. Pewne znaczenie ma też kształt oraz inne oddziaływania z ośrodkiem, którym może być roztwór lub specjalny żel, rzadziej bibuła.

Jak to ma się jednak do badania DNA? Przecież w każdej komórce jest jedna, taka sama cząsteczka, co tu więc do rozdzielania? Dobre pytanie. Biolodzy też długo nie mogli wpaść na to jak to zrobić, aż wreszcie ktoś odkrył enzymy restrykcyjne i wszystko stało się jasne.
Restryktazy to specyficzne enzymy wytwarzane przez bakterie i sinice, zapewne jako mechanizm obronny przed wirusami. Rozcinają one łańcuch DNA na obu niciach w miejscu w którym pojawia się specyficzna sekwencja zasad nukleinowych. Na przykład enzym EcoR I rozcina DNA w miejscu komplementarnych sekwencji GAATTC i CTTAAG, enzym Taq I w miejscu TCGA i AGCT, zaś Not I w miejscu GCGGCCGC i CGCCGGCG. Jak łatwo się domyśleć, ponieważ różne osoby mają różne geny, po rozcięciu ich DNA postanie nam mieszanina fragmentów i różnej długości i wielkości frakcji.

Powiedzmy że mamy łańcuch o zasadach: CCCAGAGGCCTTCTGGAGGAGTTGTTATCCTCGAAGACCACCGTTGACAGATT
i trzy enzymy, jeden rozcina łańcuch w miejscu AGA, drugi w GTTG a trzeci w TCCT.
Po zmieszaniu roztworu łańcucha z pierwszy otrzymamy mieszaninę fragmentów:
-ATT
-CCCAG
--ACCACCGTTGACAG
-AGGCCTTCTGGAGGAGTTATTGTCCTCGAAG

Z drugim:
-CCCAGAGGCCTTCTGGAGGAGT
-TGTTATCCTCGAAGACCACCGT
-TGACAGATT

Z trzecim:
-CCCAGAGGCCTTCTGGAGGAGTTGTTATC
-CTCGAAGACCACCGTTGACAGATT

Im dłuższy fragment tym wolniej będzie się poruszał a więc tym bliżej znajdzie się miejsca naniesienia. Jeśli więc weźmiemy naszą próbkę łańcucha, potraktujemy osobno trzema enzymami i naniesiemy na płytkę, to otrzymamy w przybliżeniu coś takiego:

Jeden enzym dał dwa długie fragmenty, drugi dwa długie i jeden krótki a trzeci cztery różnej długości. Jeśli dysponujemy długim łańcuchem i porozdzielamy go kilkoma lub kilkunastoma enzymami, otrzymamy na płytce wzór składający się z prążków o różnym przesunięciu i natężeniu, a liczba wszystkich możliwych kombinacji jest olbrzymia. W badaniach DNA zakłada się, że dla różnych ludzi wzór utrwalony na płytce będzie różny, stąd możliwość identyfikcji tożsamości lub pokrewieństwa.

W naszym pokazowym doświadczeniu procedurę mieliśmy już o tyle uproszczoną, że próbką badaną był wzorcowy roztwór pociętego DNA plazmidowego, pozostawało nam zatem przygotować płytkę i nanieść próbkę. Ten typ badania standardowo wykonuje się w żelu agarozowym. Agaroza to właściwy środek żelujący wyodrębniany z agaru naturalnego. Przygotowanie jest dosyć proste. Odważoną ilość agaru należało rozpuścić w gorącym roztworze zasadowego buforu, dodać odczynnika barwiącego kwasy nukleinowe i przelać do odpowiedniej kuwety, wkładając przed zatężeniem plastikowy "grzebień". Po zastygnięciu w miejscu grzebienia pozostają równe zagłębienia, stanowiące kuwetki na próbki:

Po oznaczeniu spektrofotometrycznie stężenia wzorca i po zmieszaniu go z roztworem barwnika należało pobrać go mikropitetą i wkroplić do zagłębień. Cała płytka była już wtedy zalana roztworem elektrolitu, dlatego nieco cięższy roztwór próbki należało bardzo ostrożnie umieścić w zagłębieniach, tak aby nie wypłynął - co nie było wcale takie łatwe. A potem należało włączyć prąd i poczekać. Jako że mamy tu do czynienia z kwasem organicznym, należy oczekiwać że w środowisku zasadowym na resztach fosforanowym pojawią się ładunki ujemne, a zatem cała cząsteczka będzie wędrowała ku dodatnio naładowanej anodzie.

DNA jest bezbarwne, jak więc ujawnić prążki frakcji? Zajął się tym dodany do żelu odczynnik, którym był w tym przypadku bromek etydyny, związek organiczny mającego skłonność do tworzenia trwałych kompleksów z DNA, wpasowując się pomiędzy nicie. W związku z tym przy pracy z nim należało zachować ostrożność, łatwo bowiem wchłania się przez skórę a z racji właściwości jest silnym mutagenem. Bromek ma też tą właściwość, że wyraźnie świeci w świetle ultrafioletowym. Dlatego po odczekaniu odpowiedniego czasu wyjęliśmy żel z płytki i w zaciemnionym pomieszczeniu podświetliliśmy ultrafioletem, ujawniając nieco może niewyraźne ale widoczne prążki frakcji.

Nie próbujcie tego w domu...

wtorek, 27 grudnia 2011